Blog
MutationHuman
Data Analysis Part 1 – MutationHuman cystic fibrosis transmembrane conductance regulator (CFTR) mRNA
- The cDNA sequence representing the complete mRNA of the normal or wild-type human CFTR gene is given in Appendix I. Use this to determine the amino acid sequence of the protein.
There are several DNA translation tools that you can use for this:
https://web.expasy.org/translate/
https://www.ebi.ac.uk/Tools/st/emboss_transeq/
Which reading frame gives you the correct protein sequence (remember you only need to translate the top strand)?
- Identify the protein coding sequence (that is, the region which is translated into protein), and the 3’ and 5’ untranslated regions and complete Table 1. How many amino acids are encoded by this region?
Table 1. CFTR mRNA features
| Feature | Nucleotide positions |
| 3’ UTR | |
| Coding sequence (CDS) | |
| 5’ UTR |
- Over 1700 mutations have been identified in the CFTR gene that are associated with cystic fibrosis. Four of the most common ones are listed in Table 2.
For each of the mutations determine (i) what kind of mutation it is (missense, nonsense) and (ii) what is the effect of the mutation on the protein sequence.
To do this you will need to identity and change the relevant nucleotide(s) in the wild-type cDNA and then use a translation tool to determine the effect on the protein. You can then use programmes designed to align multiple sequences to compare the mutant proteins to the wild-type. The most commonly used is Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/).
Table 2. Common CFTR mutations
| Mutation | Nucleotide position(s)* | Mutation type | Amino acid change | Protein domain affected |
| M1: G → A | 420 | Missense | R117H | TMD 1 |
| M2: del CTT | 1591 -1593 | 3 bp deletion | Deletion of F508 | ATP binding domain 1 |
| M3: G → T | 1694 | Nonsense | G542X | Premature termination |
| M4: G → A | 1722 | Nonsense | G551D | ATP binding domain 1 |
* Refers to the nucleotide position in the cDNA
- Using the information in Table 3, draw a cartoon of the CFTR protein showing the domain organisation and indicate on this the positions of the amino acid changes identified in the mutants.
Table 3. CFTR proteins domain regions
| Domain | Amino acids |
| Transmembrane domain 1 | 85 – 303 |
| ATP binding domain 1 | 389 – 670 |
| Regulatory (R) domain | 639 – 849 |
| Transmembrane domain 2 | 866 – 1147 |
| ATP binding domain 2 | 1208 – 1480 |
- A patient was diagnosed with CF; neither parent had CF. Routine analysis identified a known mutant allele on one chromosome and an unknown mutant allele on the other chromosome. The novel mutation was found to be located between exons 8-11. RT-PCR analysis was carried out on RNA samples from the patient and both parents, using primers designed to amplify this region (Figure 1B). The PCR products were analysed by agarose gel electrophoreses (Figure 1A) and then sequenced (Appendix II).
Figure 1: (A) Analysis of RT-PCR products of RNA isolated from blood samples of the patient (J28), and his mother (Mo) and father (Fa). The position of the 500 bp band in the 100 bp marker lane is indicated. (B) Sequences of the forward (F) and reverse (R) primers used in the PCR.
- Locate the position of the primers on the complete cDNA. Remember you will first need to determine the reverse complement of the R primer in order to do this.
- What size product is expected for amplification of the wild-type cDNA?
- How do you interpret the results of the RT-PCR?
- Compare the wild-type and mutant DNA sequences to determine the nature of the mutation using programmes Clustal Omega https://www.ebi.ac.uk/Tools/msa/clustalo/).
- Can you speculate how this mutation arose (hint: look at the positions of the exon junctions in the cDNA; Appendix III)?
- What protein domain is affected by the mutation and in what way?
Appendix I. CFTR cDNA sequence
Note the sequence below is presented in FASTA format, which is a text-based format used in bioinformatics to represent nucleotide or protein sequences using their single-letter abbreviations. The first line denoted by ‘>’ is a comment line and is used to identify or describe the sequence.
>human_CFTR_wildtype_cDNA_6070 bp
gtagtaggtctttggcattaggagcttgagcccagacggccctagcagggaccccagcgcccgagagaccatgcagaggtcgcctctggaaaaggccagcgttgtctccaaactttttttcagctggaccagaccaattttgaggaaaggatacagacagcgcctggaattgtcagacatataccaaatcccttctgttgattctgctgacaatctatctgaaaaattggaaagagaatgggatagagagctggcttcaaagaaaaatcctaaactcattaatgcccttcggcgatgttttttctggagatttatgttctatggaatctttttatatttaggggaagtcaccaaagcagtacagcctctcttactgggaagaatcatagcttcctatgacccggataacaaggaggaacgctctatcgcgatttatctaggcataggcttatgccttctctttattgtgaggacactgctcctacacccagccatttttggccttcatcacattggaatgcagatgagaatagctatgtttagtttgatttataagaagactttaaagctgtcaagccgtgttctagataaaataagtattggacaacttgttagtctcctttccaacaacctgaacaaatttgatgaaggacttgcattggcacatttcgtgtggatcgctcctttgcaagtggcactcctcatggggctaatctgggagttgttacaggcgtctgccttctgtggacttggtttcctgatagtccttgccctttttcaggctgggctagggagaatgatgatgaagtacagagatcagagagctgggaagatcagtgaaagacttgtgattacctcagaaatgattgaaaatatccaatctgttaaggcatactgctgggaagaagcaatggaaaaaatgattgaaaacttaagacaaacagaactgaaactgactcggaaggcagcctatgtgagatacttcaatagctcagccttcttcttctcagggttctttgtggtgtttttatctgtgcttccctatgcactaatcaaaggaatcatcctccggaaaatattcaccaccatctcattctgcattgttctgcgcatggcggtcactcggcaatttccctgggctgtacaaacatggtatgactctcttggagcaataaacaaaatacaggatttcttacaaaagcaagaatataagacattggaatataacttaacgactacagaagtagtgatggagaatgtaacagccttctgggaggagggatttggggaattatttgagaaagcaaaacaaaacaataacaatagaaaaacttctaatggtgatgacagcctcttcttcagtaatttctcacttcttggtactcctgtcctgaaagatattaatttcaagatagaaagaggacagttgttggcggttgctggatccactggagcaggcaagacttcacttctaatggtgattatgggagaactggagccttcagagggtaaaattaagcacagtggaagaatttcattctgttctcagttttcctggattatgcctggcaccattaaagaaaatatcatctttggtgtttcctatgatgaatatagatacagaagcgtcatcaaagcatgccaactagaagaggacatctccaagtttgcagagaaagacaatatagttcttggagaaggtggaatcacactgagtggaggtcaacgagcaagaatttctttagcaagagcagtatacaaagatgctgatttgtatttattagactctccttttggatacctagatgttttaacagaaaaagaaatatttgaaagctgtgtctgtaaactgatggctaacaaaactaggattttggtcacttctaaaatggaacatttaaagaaagctgacaaaatattaattttgcatgaaggtagcagctatttttatgggacattttcagaactccaaaatctacagccagactttagctcaaaactcatgggatgtgattctttcgaccaatttagtgcagaaagaagaaattcaatcctaactgagaccttacaccgtttctcattagaaggagatgctcctgtctcctggacagaaacaaaaaaacaatcttttaaacagactggagagtttggggaaaaaaggaagaattctattctcaatccaatcaactctatacgaaaattttccattgtgcaaaagactcccttacaaatgaatggcatcgaagaggattctgatgagcctttagagagaaggctgtccttagtaccagattctgagcagggagaggcgatactgcctcgcatcagcgtgatcagcactggccccacgcttcaggcacgaaggaggcagtctgtcctgaacctgatgacacactcagttaaccaaggtcagaacattcaccgaaagacaacagcatccacacgaaaagtgtcactggcccctcaggcaaacttgactgaactggatatatattcaagaaggttatctcaagaaactggcttggaaataagtgaagaaattaacgaagaagacttaaaggagtgcttttttgatgatatggagagcataccagcagtgactacatggaacacataccttcgatatattactgtccacaagagcttaatttttgtgctaatttggtgcttagtaatttttctggcagaggtggctgcttctttggttgtgctgtggctccttggaaacactcctcttcaagacaaagggaatagtactcatagtagaaataacagctatgcagtgattatcaccagcaccagttcgtattatgtgttttacatttacgtgggagtagccgacactttgcttgctatgggattcttcagaggtctaccactggtgcatactctaatcacagtgtcgaaaattttacaccacaaaatgttacattctgttcttcaagcacctatgtcaaccctcaacacgttgaaagcaggtgggattcttaatagattctccaaagatatagcaattttggatgaccttctgcctcttaccatatttgacttcatccagttgttattaattgtgattggagctatagcagttgtcgcagttttacaaccctacatctttgttgcaacagtgccagtgatagtggcttttattatgttgagagcatatttcctccaaacctcacagcaactcaaacaactggaatctgaaggcaggagtccaattttcactcatcttgttacaagcttaaaaggactatggacacttcgtgccttcggacggcagccttactttgaaactctgttccacaaagctctgaatttacatactgccaactggttcttgtacctgtcaacactgcgctggttccaaatgagaatagaaatgatttttgtcatcttcttcattgctgttaccttcatttccattttaacaacaggagaaggagaaggaagagttggtattatcctgactttagccatgaatatcatgagtacattgcagtgggctgtaaactccagcatagatgtggatagcttgatgcgatctgtgagccgagtctttaagttcattgacatgccaacagaaggtaaacctaccaagtcaaccaaaccatacaagaatggccaactctcgaaagttatgattattgagaattcacacgtgaagaaagatgacatctggccctcagggggccaaatgactgtcaaagatctcacagcaaaatacacagaaggtggaaatgccatattagagaacatttccttctcaataagtcctggccagagggtgggcctcttgggaagaactggatcagggaagagtactttgttatcagcttttttgagactactgaacactgaaggagaaatccagatcgatggtgtgtcttgggattcaataactttgcaacagtggaggaaagcctttggagtgataccacagaaagtatttattttttctggaacatttagaaaaaacttggatccctatgaacagtggagtgatcaagaaatatggaaagttgcagatgaggttgggctcagatctgtgatagaacagtttcctgggaagcttgactttgtccttgtggatgggggctgtgtcctaagccatggccacaagcagttgatgtgcttggctagatctgttctcagtaaggcgaagatcttgctgcttgatgaacccagtgctcatttggatccagtaacataccaaataattagaagaactctaaaacaagcatttgctgattgcacagtaattctctgtgaacacaggatagaagcaatgctggaatgccaacaatttttggtcatagaagagaacaaagtgcggcagtacgattccatccagaaactgctgaacgagaggagcctcttccggcaagccatcagcccctccgacagggtgaagctctttccccaccggaactcaagcaagtgcaagtctaagccccagattgctgctctgaaagaggagacagaagaagaggtgcaagatacaaggctttagagagcagcataaatgttgacatgggacatttgctcatggaattggagctcgtgggacagtcacctcatggaattggagctcgtggaacagttacctctgcctcagaaaacaaggatgaattaagtttttttttaaaaaagaaacatttggtaaggggaattgaggacactgatatgggtcttgataaatggcttcctggcaatagtcaaattgtgtgaaaggtacttcaaatccttgaagatttaccacttgtgttttgcaagccagattttcctgaaaacccttgccatgtgctagtaattggaaaggcagctctaaatgtcaatcagcctagttgatcagcttattgtctagtgaaactcgttaatttgtagtgttggagaagaactgaaatcatacttcttagggttatgattaagtaatgataactggaaacttcagcggtttatataagcttgtattcctttttctctcctctccccatgatgtttagaaacacaactatattgtttgctaagcattccaactatctcatttccaagcaagtattagaataccacaggaaccacaagactgcacatcaaaatatgccccattcaacatctagtgagcagtcaggaaagagaacttccagatcctggaaatcagggttagtattgtccaggtctaccaaaaatctcaatatttcagataatcacaatacatcccttacctgggaaagggctgttataatctttcacaggggacaggatggttcccttgatgaagaagttgatatgccttttcccaactccagaaagtgacaagctcacagacctttgaactagagtttagctggaaaagtatgttagtgcaaattgtcacaggacagcccttctttccacagaagctccaggtagagggtgtgtaagtagataggccatgggcactgtgggtagacacacatgaagtccaagcatttagatgtataggttgatggtggtatgttttcaggctagatgtatgtacttcatgctgtctacactaagagagaatgagagacacactgaagaagcaccaatcatgaattagttttatatgcttctgttttataattttgtgaagcaaaattttttctctaggaaatatttattttaataatgtttcaaacatatataacaatgctgtattttaaaagaatgattatgaattacatttgtataaaataatttttatatttgaaatattgactttttatggcactagtatttctatgaaatattatgttaaaactgggacaggggagaacctagggtgatattaaccaggggccatgaatcaccttttggtctggagggaagccttggggctgatgcagttgttgcccacagctgtatgattcccagccagcacagcctcttagatgcagttctgaagaagatggtaccaccagtctgactgtttccatcaagggtacactgccttctcaactccaaactgactcttaagaagactgcattatatttattactgtaagaaaatatcacttgtcaataaaatccatacatttgtgtgaaa
Appendix II. Sequence of RT-PCR products
>Wild-type_RT-PCR product
ctgcgcatggcggtcactcggcaatttccctgggctgtacaaacatggtatgactctcttggagcaataaacaaaatacaggatttcttacaaaagcaagaatataagacattggaatataacttaacgactacagaagtagtgatggagaatgtaacagccttctgggaggagggatttggggaattatttgagaaagcaaaacaaaacaataacaatagaaaaacttctaatggtgatgacagcctcttcttcagtaatttctcacttcttggtactcctgtcctgaaagatattaatttcaagatagaaagaggacagttgttggcggttgctggatccactggagcaggcaagacttcacttctaatggtgattatgggagaactggagccttcagagggtaaaattaagcacagtggaagaatttcattctgttctcagttttcctggattatgcctggcaccattaaagaaaatatcatctttggtgtttcctatgatg
>Mutant_RT-PCR product
ctgcgcatggcggtcactcggcaatttccctgggctgtacaaacatggtatgactctcttggagcaataaacaaaatacaggatttcttacaaaagcaagaatataagacattggaatataacttaacgactacagaagtagtgatggagaatgtaacagccttctgggaggagacttcacttctaatggtgattatgggagaactggagccttcagagggtaaaattaagcacagtggaagaatttcattctgttctcagttttcctggattatgcctggcaccattaaagaaaatatcatctttggtgtttcctatgatg
Appendix III. Exons positions
| exon | nucleotides | exon | nucleotides | exon | nucleotides | ||
| exon 1 | 1 – 123 | exon 10 | 1280 – 1462 | exon 19 | 3059 – 3209 | ||
| exon 2 | 124 – 234 | exon 11 | 1463 – 1654 | exon 20 | 3210 – 3437 | ||
| exon 3 | 235 – 343 | exon 12 | 1655 – 1749 | exon 21 | 3438 – 3538 | ||
| exon 4 | 344 – 559 | exon 13 | 1750 – 1836 | exon 22 | 3539 – 3787 | ||
| exon 5 | 560 – 649 | exon 14 | 1837 – 2560 | exon 23 | 3788 – 3943 | ||
| exon 6 | 650 – 813 | exon 15 | 2561 – 2689 | exon 24 | 3944 – 4033 | ||
| exon 7 | 814 – 939 | exon 16 | 2690 – 2727 | exon 25 | 4034 – 4206 | ||
| exon 8 | 940 – 1186 | exon 17 | 2728 – 2978 | exon 26 | 4207 – 4312 | ||
| exon 9 | 1187 – 1279 | exon 18 | 2979 – 3058 | exon 27 | 4313 – 6070 |
The post MutationHuman appeared first on AssignmentHub.

